Caulleryiosis; an uncommon Protozoan induced diarrhea in a Bull; First Report in Vertebrate host by Caullerya mesnili

Home > 2017: Vol XXV, No. 19 > Ayaz http://transylvanianreviewjournal.org/index.php/TR/article/view/1262 Muhammad Mazhar Ayaz, M. Mudaseer Nazir, Mubashir Aziz, Muhammad Amjad Ali, Muhammad Ali Khosa, Ahsan Sattar Sheikh Abstract Background: A trend in infection caused by Caullerya mesnili has been observed. Materials and Methods: A bull was presented with history of diarrhea with unresponsive to conventional antidiarrheal compounds along with some ethno-veterinary medicines. Upon detailed examination of the fresh fecal material of the bull it revealed the presence of Caullerya mesnili. Results: The micrometry was performed that was the pear-shape/ pyramid like structure and it was 15 µm at top of pear like structure and 40 µm in central width while 60 µm in length. The internal transcribed spacer (ITS) region of nuclear ribosomal DNA is a common marker for the identification of C. mesnili also. The primers designed are Specific C. mesnili-ITS1 primers (Forward: ACACCGCCCGTCACTACTAC and Reverse: TGGATATACCACTCTCAAACAG), about a fragment approximately 425 bp long. Conclusion: It was anticipated that caulleryiosis induced diarrhea can be present in vertebrates including humans. The micro-parasite like Caullerya mesnili is changing its host range and has successfully established infection in Gastro-intestinal tract other than its normal host range Daphnia.